Doing business in Spain? Interempresas Media is the key
Feria Virtual
Medición y control

Teknokroma Analitica, S.A. - Sondas para detección de productos químicos específicos

Biolegio RT-qPCR

Cebadores y sondas: para el análisis del COVID-19 por RT-qPCR de alta calidad

Foto de Cebadores y sondas
RT-qPCR es una técnica molecular ampliamente utilizada en los laboratorios para el análisis de virus por su elevada selectividad y sensibilidad.

- Sondas y cebadores para los protocolos más usuales, Charité, US CDC.

- Plazo de entrega 48h.

- Rendimiento garantizado hasta 100 nmol.

Las secuencias disponibles son:

Charité, Berlin/Erasmus MC/PublicHealthEnglandProtocol – Primers&Probes:


RdRP gene:

- Oligo ID: RdRP_SARSr-F2 / Sequence (5'-3'): GTGARATGGTCATGTGTGGCGG


- Oligo ID. RdRP_SARSr-P2 / Sequence (5'-3'): CAGGTGGAACCTCATCAGGAGATGC / Sequence (5'-3'): FAM

- Oligo ID: RdRP_SARSr-P1 / Sequence (5'-3'): CCAGGTGGWACRTCATCMGGTGATGC / Sequence (5'-3'): FAM

E gene:

- Oligo ID: E_Sarbeco_F1 / Sequence (5'-3'): ACAGGTACGTTAATAGTTAATAGCGT

- Oligo ID: E_Sarbeco_R2 / Sequence (5'-3'): ATATTGCAGCAGTACGCACACA

- Oligo ID: E_Sarbeco_P1 / Sequence (5'-3'): CACTAGCCATCCTTACTGCGCTTCG / 5' Label: FAM

US CDC Primers&ProbeSequences:



- Oligo ID: 2019-nCoV_N1 Forward Primer / Sequence (5'-3'): GAC CCC AAA ATC AGC GAA AT

- Oligo ID: 2019-nCoV_N1 Reverse Primer / Sequence (5'-3'): TCT GGT TAC TGC CAG TTG AAT CTG

- Oligo ID: 2019-nCoV_N1 Probe / Sequence (5'-3'): ACC CCG CAT TAC GTT TGG TGG ACC / 5' Label: FAM


- Oligo ID: 2019-nCoV_N2 Forward Primer / Sequence (5'-3'): GCG CGA CAT TCC GAA GAA

- Oligo ID: 2019-nCoV_N2 Forward Primer / Sequence (5'-3'): GCG CGA CAT TCC GAA GAA

- Oligo ID: 2019-nCoV_N2 Probe / Sequence (5'-3'): ACA ATT TGC CCC CAG CGC TTC AG / 5' Label: FAM


- Oligo ID: RNAse P Forward Primer / Sequence (5'-3'): AGA TTT GGA CCT GCG AGC G

- Oligo ID: RNAse P Forward Primer / Sequence (5'-3'): GAG CGG CTG TCT CCA CAA GT

- Oligo ID: RNAse P Probe/ Sequence (5'-3'): TTC TGA CCT GAA GGC TCT GCG CG / 5' Label: FAM